Welcome To Website IAS

Hot news
Achievement

Independence Award

- First Rank - Second Rank - Third Rank

Labour Award

- First Rank - Second Rank -Third Rank

National Award

 - Study on food stuff for animal(2005)

 - Study on rice breeding for export and domestic consumption(2005)

VIFOTEC Award

- Hybrid Maize by Single Cross V2002 (2003)

- Tomato Grafting to Manage Ralstonia Disease(2005)

- Cassava variety KM140(2010)

Centres
Website links
Vietnamese calendar
Library
Visitors summary
 Curently online :  6
 Total visitors :  4126020

High-resolution genetic mapping of rice bacterial blight resistance gene Xa23
Tuesday, 2014/09/30 | 07:54:15

Chunlian Wang, Yinglun Fan, Chongke Zheng, Tengfei Qin, Xiaoping Zhang, Kaijun Zhao

Molecular Genetics and Genomics, October 2014, Volume 289, Issue 5, pp 745-753

http://link.springer.com/article/10.1007/s00438-014-0848-y?wt_mc=alerts.TOCjournals

 

Abstract

 

Bacterial blight (BB) caused by Xanthomonas oryzae pv. oryzae (Xoo) is the most devastating bacterial disease of rice (Oryza sativa L.), a staple food crop that feeds half of the world’s population. In management of this disease, the most economical and effective approach is cultivating resistant varieties. Due to rapid change of pathogenicity in the pathogen, it is necessary to identify and characterize more host resistance genes for breeding new resistant varieties. We have previously identified the BB resistance (R) gene Xa23 that confers the broadest resistance to Xoo strains isolated from different rice-growing regions and preliminarily mapped the gene within a 1.7 cm region on the long arm of rice chromosome 11. Here, we report fine genetic mapping and in silico analysis of putative candidate genes of Xa23. Based on F2 mapping populations derived from crosses between Xa23-containing rice line CBB23 and susceptible varieties JG30 or IR24, six new STS markers Lj36, Lj46, Lj138, Lj74, A83B4, and Lj13 were developed. Linkage analysis revealed that the new markers were co-segregated with or closely linked to the Xa23 locus. Consequently, the Xa23 gene was mapped within a 0.4 cm region between markers Lj138 and A83B4, in which the co-segregating marker Lj74 was identified. The corresponding physical distance between Lj138 and A83B4 on Nipponbare genome is 49.8 kb. Six Xa23 candidate genes have been annotated, including four candidate genes encoding hypothetical proteins and the other two encoding a putative ADP-ribosylation factor protein and a putative PPR protein. These results will facilitate marker-assisted selection of Xa23 in rice breeding and molecular cloning of this valuable R gene.

 

>gi|63098483|gb|AY885790.1| Oryza sativa (indica cultivar-group) isolate Xa23 receptor kinase-like protein (Xa21) gene, partial cds

TTGATAAGATCACAGGAAGCATTCCAAAGGATATTGGCAATCTTATTGGCTTACAACATCTCTATCTCTG

CAACAACAATTTCAGAGGGTCACTTCCATCATCGTTGGGCAGGCTTAGAAACTTAGGCATTCTAGTCGCC

TACGAAAACAACTTGAGCGGTTCGATCCCATTGGCCATAGGAAATCTTACTGAACTTAATATCTTACTGC

TCGGCACCAACAAATTCAGTGGTTGGATACCATACACACTCTCAAACCTCACAAACTTGTTGTCATTAGG

CCTTTCAACTAATAACCTTAGTGGTCCAATACCCAGTGAATTATTCAATATTCAAACACTATCAATAATG

ATCAATGTATCAAAAAATAACTTGGAGGGATCAATACCACAAGAAATAGGGCATCTCAAAAATCTAGTAG

AATTTCATGCAGAATCGAATAGATTATCAGGTAAAATCCCTAACACGCTTGGTGATTGCCAGCTCTTACG

GTATCTTTATCTGCAAAATAATTTGTTATCTGGTAGCATCCCATCAGCCTTGGGTCAGCTGAAAGGTCTC

GAAACTCTTGATCTCTCAAGCAACAATTTGTCAGGCCAGATACCCACATCCTTAGCAGATATTACTATGC

TTCATTCCTTGAACCTTTCTTTCAACAGCTTTATGGGGGAAGTGCCAACCATTGGTGCTTTCGCAGATGC

ATCCGGGATCTCAATCCAAGGCAATGCCAAACTCTGTGGTGGAATACCTGATCTACATCTGCCTCGATGT

TGTCCATTACTAGAGAATAGAAAACATTTCCCAGTTCTACCTATTTCTGTTTCTCTGGTCGCAGCACTGG

CCATCCTCTCATCACTCTACTTGCTTATAACCTGGCACAAGAGAACTAAAAAGGGAGCCCCTTCAAGAAC

TTCCATGAAAGGCCACCCATTGGTCTCTTATTCGCAGTTGGTAAAAGCAACAGATGGTTTCGCGCCGACT

AATTTGTTGGGTTCTGGATCATTTGGCTCAGTATACAAAGGAAAGCTTAATATCCAAGATCATGTTGCAG

TGAAGGTACTAAAGCTTGAAAATCCTAAGGCACTCAAGAGT

Figure: DNA sequence of 1,091 nucleotides

 

 

Back      Print      View: 2349

[ Other News ]___________________________________________________
  • Genome-wide analysis of autophagy-associated genes in foxtail millet (Setaria italica L.) and characterization of the function of SiATG8a in conferring tolerance to nitrogen starvation in rice.
  • Arabidopsis small nucleolar RNA monitors the efficient pre-rRNA processing during ribosome biogenesis
  • XA21-specific induction of stress-related genes following Xanthomonas infection of detached rice leaves.
  • Reducing the Use of Pesticides with Site-Specific Application: The Chemical Control of Rhizoctonia solani as a Case of Study for the Management of Soil-Borne Diseases
  • OsJRL, a rice jacalin-related mannose-binding lectin gene, enhances Escherichia coli viability under high-salinity stress and improves salinity tolerance of rice.
  • Production of lipopeptide biosurfactants by Bacillus atrophaeus 5-2a and their potential use in microbial enhanced oil recovery.
  • GhABF2, a bZIP transcription factor, confers drought and salinity tolerance in cotton (Gossypium hirsutum L.).
  • Resilience of cassava (Manihot esculenta Crantz) to salinity: implications for food security in low-lying regions.
  • Cellulose synthase complexes act in a concerted fashion to synthesize highly aggregated cellulose in secondary cell walls of plants
  • No adverse effects of transgenic maize on population dynamics of endophytic Bacillus subtilis strain B916-gfp
  • Identification and expression analysis of OsLPR family revealed the potential roles of OsLPR3 and 5 in maintaining phosphate homeostasis in rice
  • Functional analysis of molecular interactions in synthetic auxin response circuits
  • Titanium dioxide nanoparticles strongly impact soil microbial function by affecting archaeal nitrifiers.
  • Inducible Expression of the De-Novo Designed Antimicrobial Peptide SP1-1 in Tomato Confers Resistance to Xanthomonas campestris pv. vesicatoria.
  • Toward combined delignification and saccharification of wheat straw by a laccase-containing designer cellulosome
  • SNP-based discovery of salinity-tolerant QTLs in a bi-parental population of rice (Oryza sativa)
  • Pinpointing genes underlying the quantitative trait loci for root-knot nematode resistance in palaeopolyploid soybean by whole genome resequencing.
  • Transcriptome- Assisted Label-Free Quantitative Proteomics Analysis Reveals Novel Insights into Piper nigrum -Phytophthora capsici Phytopathosystem.
  • Brassinosteroids participate in the control of basal and acquired freezing tolerance of plants
  • Rapid hyperosmotic-induced Ca2+ responses in Arabidopsis thaliana exhibit sensory potentiation and involvement of plastidial KEA transporters
Designed & Powered by WEBSO CO.,LTD