Welcome To Website IAS

Hot news
Achievement

Independence Award

- First Rank - Second Rank - Third Rank

Labour Award

- First Rank - Second Rank -Third Rank

National Award

 - Study on food stuff for animal(2005)

 - Study on rice breeding for export and domestic consumption(2005)

VIFOTEC Award

- Hybrid Maize by Single Cross V2002 (2003)

- Tomato Grafting to Manage Ralstonia Disease(2005)

- Cassava variety KM140(2010)

Centres
Website links
Vietnamese calendar
Library
Visitors summary
 Curently online :  3
 Total visitors :  4099229

High-resolution genetic mapping of rice bacterial blight resistance gene Xa23

Bacterial blight (BB) caused by Xanthomonas oryzae pv. oryzae (Xoo) is the most devastating bacterial disease of rice (Oryza sativa L.), a staple food crop that feeds half of the world’s population. In management of this disease, the most economical and effective approach is cultivating resistant varieties. Due to rapid change of pathogenicity in the pathogen, it is necessary to identify and characterize more host resistance genes for breeding new resistant varieties.

Chunlian Wang, Yinglun Fan, Chongke Zheng, Tengfei Qin, Xiaoping Zhang, Kaijun Zhao

Molecular Genetics and Genomics, October 2014, Volume 289, Issue 5, pp 745-753

http://link.springer.com/article/10.1007/s00438-014-0848-y?wt_mc=alerts.TOCjournals

 

Abstract

 

Bacterial blight (BB) caused by Xanthomonas oryzae pv. oryzae (Xoo) is the most devastating bacterial disease of rice (Oryza sativa L.), a staple food crop that feeds half of the world’s population. In management of this disease, the most economical and effective approach is cultivating resistant varieties. Due to rapid change of pathogenicity in the pathogen, it is necessary to identify and characterize more host resistance genes for breeding new resistant varieties. We have previously identified the BB resistance (R) gene Xa23 that confers the broadest resistance to Xoo strains isolated from different rice-growing regions and preliminarily mapped the gene within a 1.7 cm region on the long arm of rice chromosome 11. Here, we report fine genetic mapping and in silico analysis of putative candidate genes of Xa23. Based on F2 mapping populations derived from crosses between Xa23-containing rice line CBB23 and susceptible varieties JG30 or IR24, six new STS markers Lj36, Lj46, Lj138, Lj74, A83B4, and Lj13 were developed. Linkage analysis revealed that the new markers were co-segregated with or closely linked to the Xa23 locus. Consequently, the Xa23 gene was mapped within a 0.4 cm region between markers Lj138 and A83B4, in which the co-segregating marker Lj74 was identified. The corresponding physical distance between Lj138 and A83B4 on Nipponbare genome is 49.8 kb. Six Xa23 candidate genes have been annotated, including four candidate genes encoding hypothetical proteins and the other two encoding a putative ADP-ribosylation factor protein and a putative PPR protein. These results will facilitate marker-assisted selection of Xa23 in rice breeding and molecular cloning of this valuable R gene.

 

>gi|63098483|gb|AY885790.1| Oryza sativa (indica cultivar-group) isolate Xa23 receptor kinase-like protein (Xa21) gene, partial cds

TTGATAAGATCACAGGAAGCATTCCAAAGGATATTGGCAATCTTATTGGCTTACAACATCTCTATCTCTG

CAACAACAATTTCAGAGGGTCACTTCCATCATCGTTGGGCAGGCTTAGAAACTTAGGCATTCTAGTCGCC

TACGAAAACAACTTGAGCGGTTCGATCCCATTGGCCATAGGAAATCTTACTGAACTTAATATCTTACTGC

TCGGCACCAACAAATTCAGTGGTTGGATACCATACACACTCTCAAACCTCACAAACTTGTTGTCATTAGG

CCTTTCAACTAATAACCTTAGTGGTCCAATACCCAGTGAATTATTCAATATTCAAACACTATCAATAATG

ATCAATGTATCAAAAAATAACTTGGAGGGATCAATACCACAAGAAATAGGGCATCTCAAAAATCTAGTAG

AATTTCATGCAGAATCGAATAGATTATCAGGTAAAATCCCTAACACGCTTGGTGATTGCCAGCTCTTACG

GTATCTTTATCTGCAAAATAATTTGTTATCTGGTAGCATCCCATCAGCCTTGGGTCAGCTGAAAGGTCTC

GAAACTCTTGATCTCTCAAGCAACAATTTGTCAGGCCAGATACCCACATCCTTAGCAGATATTACTATGC

TTCATTCCTTGAACCTTTCTTTCAACAGCTTTATGGGGGAAGTGCCAACCATTGGTGCTTTCGCAGATGC

ATCCGGGATCTCAATCCAAGGCAATGCCAAACTCTGTGGTGGAATACCTGATCTACATCTGCCTCGATGT

TGTCCATTACTAGAGAATAGAAAACATTTCCCAGTTCTACCTATTTCTGTTTCTCTGGTCGCAGCACTGG

CCATCCTCTCATCACTCTACTTGCTTATAACCTGGCACAAGAGAACTAAAAAGGGAGCCCCTTCAAGAAC

TTCCATGAAAGGCCACCCATTGGTCTCTTATTCGCAGTTGGTAAAAGCAACAGATGGTTTCGCGCCGACT

AATTTGTTGGGTTCTGGATCATTTGGCTCAGTATACAAAGGAAAGCTTAATATCCAAGATCATGTTGCAG

TGAAGGTACTAAAGCTTGAAAATCCTAAGGCACTCAAGAGT

Figure: DNA sequence of 1,091 nucleotides

 

 

Trở lại      In      Số lần xem: 2334

[ Tin tức liên quan ]___________________________________________________
Designed & Powered by WEBSO CO.,LTD