Welcome To Website IAS

Hot news
Achievement

Independence Award

- First Rank - Second Rank - Third Rank

Labour Award

- First Rank - Second Rank -Third Rank

National Award

 - Study on food stuff for animal(2005)

 - Study on rice breeding for export and domestic consumption(2005)

VIFOTEC Award

- Hybrid Maize by Single Cross V2002 (2003)

- Tomato Grafting to Manage Ralstonia Disease(2005)

- Cassava variety KM140(2010)

Centres
Website links
Vietnamese calendar
Library
Visitors summary
 Curently online :  10
 Total visitors :  7427083

Editing VvDXS1 for the creation of muscat flavour in Vitis vinifera cv. Scarlet Royal
Wednesday, 2024/02/07 | 08:50:34

Yingzhen YangMatthew WheatleyVictoria MeakemErin GalarneauBenjamin GutierrezGan-Yuan Zhong

First published: 20 January 2024; https://doi.org/10.1111/pbi.14290

 

Summary

Muscat flavour represents a group of unique aromatic attributes in some grape varieties. Biochemically, grape berries with muscat flavour produce high levels of monoterpenes. Monoterpene biosynthesis is mainly through the DOXP/MEP pathway, and VvDXS1 encodes the first enzyme in this plastidial pathway of terpene biosynthesis in grapevine. A single-point mutation resulting in the substitution of a lysine with an asparagine at position 284 in the VvDXS1 protein has previously been identified as the major cause for producing muscat flavour in grapes. In this study, the same substitution in the VvDXS1 protein was successfully created through prime editing in the table grape Vitis vinifera cv. ‘Scarlet Royal’. The targeted point mutation was detected in most of the transgenic vines, with varying editing efficiencies. No unintended mutations were detected in the edited alleles, either by PCR Sanger sequencing or by amplicon sequencing. More than a dozen edited vines were identified with an editing efficiency of more than 50%, indicating that these vines were likely derived from single cells in which one allele was edited. These vines had much higher levels of monoterpenes in their leaves than the control, similar to what was found in leaf samples between field-grown muscat and non-muscat grapes.

 

See https://onlinelibrary.wiley.com/doi/10.1111/pbi.14290?fbclid=IwAR3cDltrpRycNYeM6OkEE54IzlB2JkZBn9iR6DEugTfs7SQsUj5lwzYgVig

 

Figure 1: Schematic representation of VvDXS1, PE guide RNAs (pegRNA), and PE constructs. (a) Schematic illustration of the VvDXS1 gene. VvDXS1 contains 10 exons (E1 to E10). Lys284 is at the junction between exon 5 and intron 5. The primer pair 1529/1530 was used for genomic PCR and genotyping of transgenic plants; the primer pair 1582/1515 was used for amplicon sequencing to estimate PE efficiency; the primer pair 1706/1705 was used for amplifying the cDNA region at the target site; and the primer pair 1686/1694 was used for VvDXS1 full-length cDNA amplification. (b) Genomic sequence flanking Lys284 includes part of exon 5 and part of intron 5. The intended gene editing is to change “G” in AAG (red box) to “C” in AAC (purple box) so that the amino acid Lys284 is converted to Asn284 for mimicking the natural muscat VvDXS1m allele for most muscat-flavoured cultivars regarding the amino acid change. An AclI restriction enzyme site (AACgtt) is introduced as a result of the editing. The spacer sequences were marked by coloured texts and arrows and the primer binding sequences (PBS) for the paired pegRNAs were marked by black boxes. (c) Simplified sequence representations of epegRNA1 and epegRNA2. RT: reverse transcript template. TevopreQ1 is the RNA stabilizing motif (“CGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAA”) added to the end of pegRNA to form epegRNA (Nelson et al., 2022). (d) A schematic illustration of the VvDXS1 PE constructs PD1 and PD2. T-DNA is 13.9 kb for PD1 and 15.4 kb for PD2 between the left border (blue strip) and the right border (black strip). Both constructs had the e35S:Hpt marker for plant selection and VvU6.2:paired-epegRNAs cassette (two enhanced PE guiding RNAs spaced by tRNA as a single polycistronic gene driven by the grape U6.2 promoter. PEMax (a modified prime editor) was used in both PD1 and PD2. However, PEMax was under a 35S promoter in PD1 and under a VvUbi2 promoter in PD2. Furthermore, a 35S:eGFP cassette was included in PD1 for visual tracking of the transformation process. In PD2, a 35S:VvMLHdn cassette was inserted in a similar position instead to enhance PE efficiency.

Back      Print      View: 65

[ Other News ]___________________________________________________
  • Genome-wide analysis of autophagy-associated genes in foxtail millet (Setaria italica L.) and characterization of the function of SiATG8a in conferring tolerance to nitrogen starvation in rice.
  • Arabidopsis small nucleolar RNA monitors the efficient pre-rRNA processing during ribosome biogenesis
  • XA21-specific induction of stress-related genes following Xanthomonas infection of detached rice leaves.
  • Reducing the Use of Pesticides with Site-Specific Application: The Chemical Control of Rhizoctonia solani as a Case of Study for the Management of Soil-Borne Diseases
  • OsJRL, a rice jacalin-related mannose-binding lectin gene, enhances Escherichia coli viability under high-salinity stress and improves salinity tolerance of rice.
  • Production of lipopeptide biosurfactants by Bacillus atrophaeus 5-2a and their potential use in microbial enhanced oil recovery.
  • GhABF2, a bZIP transcription factor, confers drought and salinity tolerance in cotton (Gossypium hirsutum L.).
  • Resilience of cassava (Manihot esculenta Crantz) to salinity: implications for food security in low-lying regions.
  • Cellulose synthase complexes act in a concerted fashion to synthesize highly aggregated cellulose in secondary cell walls of plants
  • No adverse effects of transgenic maize on population dynamics of endophytic Bacillus subtilis strain B916-gfp
  • Identification and expression analysis of OsLPR family revealed the potential roles of OsLPR3 and 5 in maintaining phosphate homeostasis in rice
  • Functional analysis of molecular interactions in synthetic auxin response circuits
  • Titanium dioxide nanoparticles strongly impact soil microbial function by affecting archaeal nitrifiers.
  • Inducible Expression of the De-Novo Designed Antimicrobial Peptide SP1-1 in Tomato Confers Resistance to Xanthomonas campestris pv. vesicatoria.
  • Toward combined delignification and saccharification of wheat straw by a laccase-containing designer cellulosome
  • SNP-based discovery of salinity-tolerant QTLs in a bi-parental population of rice (Oryza sativa)
  • Pinpointing genes underlying the quantitative trait loci for root-knot nematode resistance in palaeopolyploid soybean by whole genome resequencing.
  • Transcriptome- Assisted Label-Free Quantitative Proteomics Analysis Reveals Novel Insights into Piper nigrum -Phytophthora capsici Phytopathosystem.
  • Brassinosteroids participate in the control of basal and acquired freezing tolerance of plants
  • Rapid hyperosmotic-induced Ca2+ responses in Arabidopsis thaliana exhibit sensory potentiation and involvement of plastidial KEA transporters

 

Designed & Powered by WEBSO CO.,LTD