Chào mừng Quý độc giả đến với trang thông tin điện tử của Viện Khoa học Kỹ thuật Nông nghiệp miền Nam

Tin nổi bật
Thành tích

Huân chương Ðộc lập

- Hạng 1 - Hạng 2 - Hạng 3

Huân chương Lao động

- Hạng 1 - Hạng 2 - Hạng 3

Giải thưởng Nhà nước

- Nghiên cứu dinh dưởng và thức ăn gia súc (2005)

- Nghiên cứu chọn tạo và phát triển giống lúa mới cho xuất khẩu và tiêu dùng nội địa (2005)

Giải thưởng VIFOTEC

- Giống ngô lai đơn V2002 (2003)

- Kỹ thuật ghép cà chua chống bệnh héo rũ vi khuẩn (2005)

- Giống Sắn KM 140 (2010)

Trung tâm
Liên kết website
lịch việt
Thư viện ảnh
Video
Nông nghiệp 4.0 – Cơ hội cho nông nghiệp Việt Nam

Thống kê truy cập
 Đang trực tuyến :  12
 Số lượt truy cập :  19941824
Xác định tác nhân, thực trạng bệnh cằn mía gốc ở miền Đông Nam Bộ và biện pháp phòng trừ bệnh trong sản xuất mía giống cơ bản (Luận án TS. Hà Đình Tuấn, năm 2012, Đại học Nông Lâm Tp HCM (bản tóm tắt), Viện KHKT NN Miền Nam)
Thứ tư, 29-08-2012 | 09:38:29

Tóm tắt

Nghiên cứu xác định tác nhân gây bệnh cằn mía gốc dựa trên đặc điểm hình thái, sinh hóa và sinh học phân tử. Đánh giá hiện trạng bệnh cằn mía gốc ở miền Đông Nam Bộ và nghiên cứu một số biện pháp phòng trừ trong sản xuất mía giống cơ bản thông qua các thí nghiệm ruộng đồng nhằm xây dựng quy trình phòng trừ bệnh cằn mía gốc trong sản xuất mía giống cơ bản, góp phần thiết lập chương trình sản xuất mía giống sạch bệnh cho các vùng mía nguyên liệu.

Trên môi trường SC bổ sung acid nalidixic 10 mg/ml, khuẩn lạc hình tròn, không màu đến trắng nhạt với đường kính khoảng 0,19 mm và biến động từ 0,09 đến 0,30 mm. Vi khuẩn tạo ra phản ứng catalase dương tính nhưng cho phản ứng oxydase, methyl red âm tính, không sản sinh H2S, không phân hủy urea và không phân giải tinh bột. Vi khuẩn Gram dương có hình que, chùy với kích thước khoảng 0,37 -0,48 mm x 1,1 - 1,8 mm mang nét đặc trưng của nhóm Coryneform khi tạo liên kết trên bề mặt môi trường dạng hình chử V/Y; thực hiện theo quy tắc Koch cho triệu chứng đặc trưng của bệnh cằn mía gốc. Khuếch đại vùng 16-23S rRNA của vi khuẩn thu thập trên các giống mía ở miền Đông Nam Bộ cho kích thước sản phẩm PCR ở vị trí khoảng 348bp khi sử dụng primer Cxx1(CCGAAGTGAGCAGATTGACC)/Cxx2(ACCCTGTGTTGTTTTCAACG) và 392bp với primer Lx1(CATTGACATTGGTGCAGAGC)/Lx2(CATCCACCGTTTGCTCTTAG) sau khi điện di trên gel agarose (1%) chứa ethidium bromide (0,5 mg/ml). So sánh các trình tự DNA của 8 mẫu vi khuẩn thu thập trên các giống mía ở miền Đông Nam Bộ cho thấy có sự tương đồng rất cao giữa các mẫu này với nhau cũng như so với các trình tự chứa vùng 16-23S rRNA của Leifsonia xyli subsp. xyli trên GenBank.

Kết quả khảo sát cho thấybệnh cằn mía gốc xuất hiện rất phổ biến trên các hiống mía ngoài sản xuất ở miền Đông Nam Bộ, thiệt hại do bệnh gây ra ở múc 22,66% khối lượng cây, trong trường hợp nhiễm nặng có thể gây thất thu đến 46,19%. Sự ảnh hưởng tùy thuộc vào tình trạng mía (vụ tơ hay vụ mía gốc) và liên quan đến yếu tố giống khác nhau, không phụ thuộc vào giống mía mới hay giống mía cũ đã qua canh tác thời gian dài.

Kết quả nghiên cứu về sự lây lan bệnh cằn mía gốc cho thấy lưỡi dao tiếp xúc với nguồn bệnh có thể làm giảm khối lượng cây đến 15 hom. Khối lượng cây giảm trầm trọng hơn khi tiếp xúc với nguồn bệnh cao, điều này xuất hiện không rõ rệt ở hom thứ 25 sau khi lưỡi dao nhiễm vi khuẩn gây bệnh cằn mía gốc. Đồng thời, kết quả cũng cho thấy bệnh cằn mía gốc không làm ảnh hưởng đến chất lượng mía trong chu kỳ 3 vụ (1 vụ mía tơ và 2 vụ gốc).

Bệnh cằn mía gốc có thể làm giảm năng suất đến 18,04% trên vụ mía tơ và 33,58% trên vụ mía gốc 1 trong điều kiện khô hạn, đồng thời làm giảm từ 5,00 đến 10,61% trên mía tơ và từ 9,29 đến 14,36% trên vụ mía gốc 1 trong điều kiện có tưới. Tưới nước 3 đến 5 ngày/lần với lượng nước 200m3/ha/lần cho mía tơ trong mùa khô ở miần Đông Nam Bộ có thể tạo ra tỷ lệ mạch hoạt động cao, tăng khả năng đẻ nhánh, mật độ cây hữu hiệu, khối lượng cây, năng suất và góp phần làm giảm thiệt hại do bệnh cằn mía gốc gây ra.

Xử lý hom bằng nước nóng ở 50,5oC/2 giờ phòng trừ bệnh cằn mía gốc đạt hiệu quả cao, giúp tăng các chỉ tiêu sinh trưởng, mạch hoạt động và các yếu tố cấu thành năng suất dẫn đến tăng năng suất ổn định ở cả vụ mía tơ và mía gốc 1. Mô hình xử lý hom bằng nước nóng 50,5oC/2giờ giúp tạo ra tỷ lệ mạch hoạt động cao với 98,6% trong vụ 1 nhờ nước mưa và đạt 99,4% trong vụ 2 có tưới; có thể đạt được hệ số nhân 12,3 lần khi trồng vụ đầu mưa và 11,8 lần nếu trồng trong vụ cuối mưa có tưới.

 

Trở lại      In      Số lần xem: 2236

[ Tin tức liên quan ]___________________________________________________
Designed & Powered by WEBSO CO.,LTD